Anton Meenan-1st April

I had an update on the bird news from Tory. Good numbers of Greylag Geese, Whooper Swans and Redwings moving north over the last week or so. One of the two Glaucous Gulls still remains. A Song Thrush has been in song since february..unheard of on Tory. Wheatear were early this year with the first bird on 11th March and 4 birds present on 28th March.A couple of Robins overwintered and a pair are present in Grace's Garden. The Tree Sparrows are back on the island, with up to 13 birds present but a migrating Merlin has taken a couple and at least one of the 3 resident Reed Bunting. A few Chiffchaffs moving through and the best a male Black Redstart on Anton's lawn this morning.

2011 Tory Island Bird Report

The printed edition of the 2011 Tory Island Bird Report will be available is available to order. It was previously only available as a download. Chris Ingram has kindly arranged to get the report printed. All proceeds from the sale of the report will go to charity.

Anyone who is interested in buying a copy should contact Chris at chrisingram43@hotmail.com

14th March; Chris Ingram

I had an email from Chris Ingram, who made the first trip of the season out to Tory yesterday.
(The King of Tory will have his 70th Birthday celebrations tonight....)

I went to Tory yesterday; it was very cold, windy with drizzle most of day so not ideal conditions. I just covered the West. Here is the list:

Mute Swan 1 pair on west lake, 1 pair on marsh
Whooper Swan 1 on west lake
Mallard 3 pairs on west lake, 1 pair on marsh
Tufted Duck 7 on west lake
Eider 4 offshore
Great Northern Diver 1 in harbour
Shag
Oystercatcher
Ringed Plover
Lapwing 3 pairs displaying lighthouse road, 2 pairs displaying marsh and 9 in flight behind West Town
Dunlin 1 on beach
Curlew
Redshank
Turnstone
Common Gull
Herring Gull
Great Black Backed Gull
Rock Dove
Chough 6 in flight together
Hooded Crow
Raven
Skylark 2
Wren 1
Starling
Redwing 1
Tree Sparrow 14 at Anton's
Pied Wagtail
Meadow Pipit
Rock Pipit including albino/leucistic bird
Reed Bunting 1 at Antons

Eastern Yellow Wagtail

Just recieved this email ......

We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The crap sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the 'northeast' clade of Yellow Wags i.e. plexa or tschutschensis. It's not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different. Genetically you are in the same position as the Brits, because tschutschensis is Eastern Yellow Wag, but plexa is classifed as eastern or western depending on whether you are AOU or IOC. However informally we thought the plumage of the Devon bird pushed it more into the tschutschensis camp.



Hope this helps. I know I've received samples from more than one person, and as I'm not at work to check there might be people who've sent stuff who aren't in this email. If you know of anyone, please pass this on.


Best wishes
Martin



Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACTCCTAGGAACCACCATCACTATCTCGAGCAACCACTGAATCATGGCCTGGGCCGGCCTGGAAATTAACACACTAGCCATCCTAC
CACTAATCTCAAAATCCCACCACCCGCGGGCCATTGAAGCTGCCACTAAGTACTTCCTAGTGCAAGCAGCTGCTTCTGCCCTAGTCCTATTCTCCAGTATGACTAACGCATGAT
GTACGGGACAATGGGACATTACCCAACTCACCCACCCAACATC

2013 Tory Island Bird Report print edition

The printed edition of the 2013 Tory Island Bird Reoprt will be available to buy in a few weeks. As last year, Chris Ingram has kindly arranged to get the report printed. All proceeds from the sale of the report will go to charity.

 

Anyone who is interested in buying a copy should contact Chris at chrisingram43@hotmail.com

 

 

2013 Tory Island Bird Report

Its now available... just email me at pmpphillips@gmail.com. Its 50MB in size. I cant quite figure out why!!but its downloadable from google drive. There will also be a hard copy available to purchase in the coming weeks. I will let you know the details....

Glossy Ibis

News from a very windy Tory Island. Anton found a dead Glossy Ibis beneath the wires in west town. I think its a first for Tory.
Other news a Snow Bunting last week and what sounds like a Grey Phalarope in the harbour yesterday and today.
Very few blackbirds and just 3 Redwing. Lots of Goldfinch recently.