We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The crap sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the 'northeast' clade of Yellow Wags i.e. plexa or tschutschensis. It's not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different. Genetically you are in the same position as the Brits, because tschutschensis is Eastern Yellow Wag, but plexa is classifed as eastern or western depending on whether you are AOU or IOC. However informally we thought the plumage of the Devon bird pushed it more into the tschutschensis camp.
Hope this helps. I know I've received samples from more than one person, and as I'm not at work to check there might be people who've sent stuff who aren't in this email. If you know of anyone, please pass this on.
Best wishes
Martin
Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACT
CACTAATCTCAAAATCCCACCACCCGCGGG
GTACGGGACAATGGGACATTACCCAACTCA
No comments:
Post a Comment