I had an email from Chris Ingram, who made the first trip of the season out to Tory yesterday.
(The King of Tory will have his 70th Birthday celebrations tonight....)
I went to Tory yesterday; it was very cold, windy with drizzle most of day so not ideal conditions. I just covered the West. Here is the list:
Mute Swan 1 pair on west lake, 1 pair on marsh
Whooper Swan 1 on west lake
Mallard 3 pairs on west lake, 1 pair on marsh
Tufted Duck 7 on west lake
Eider 4 offshore
Great Northern Diver 1 in harbour
Shag
Oystercatcher
Ringed Plover
Lapwing 3 pairs displaying lighthouse road, 2 pairs displaying marsh and 9 in flight behind West Town
Dunlin 1 on beach
Curlew
Redshank
Turnstone
Common Gull
Herring Gull
Great Black Backed Gull
Rock Dove
Chough 6 in flight together
Hooded Crow
Raven
Skylark 2
Wren 1
Starling
Redwing 1
Tree Sparrow 14 at Anton's
Pied Wagtail
Meadow Pipit
Rock Pipit including albino/leucistic bird
Reed Bunting 1 at Antons
Saturday, 15 March 2014
Saturday, 8 March 2014
Eastern Yellow Wagtail
Just recieved this email ......
We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The crap sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the 'northeast' clade of Yellow Wags i.e. plexa or tschutschensis. It's not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different. Genetically you are in the same position as the Brits, because tschutschensis is Eastern Yellow Wag, but plexa is classifed as eastern or western depending on whether you are AOU or IOC. However informally we thought the plumage of the Devon bird pushed it more into the tschutschensis camp.
Hope this helps. I know I've received samples from more than one person, and as I'm not at work to check there might be people who've sent stuff who aren't in this email. If you know of anyone, please pass this on.
Best wishes
Martin
Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACT
CACTAATCTCAAAATCCCACCACCCGCGGG
GTACGGGACAATGGGACATTACCCAACTCA
We got there in the end with the Tory Island Yellow Wag (October 2013) although it was another difficult one. The crap sample provided by Peter eventually yielded some DNA, and we have been able to get a short sequence (270 bp) of ND2 sequence. Over this stretch, it is 100% identical to multiple Yellow Wag sequences previously obtained from N to NE Siberia (Anabar, Anadyr, Khabarovsk, Cherskiy, also Alaska, NE China and Mongolia) (also 100% identical to the Colyton, Devon bird) and at least 14 bp different from any Western Yellow Wag. This puts it in the 'northeast' clade of Yellow Wags i.e. plexa or tschutschensis. It's not one of the south-eastern ones (macronyx and taivana) as these are 4-5 bp different. Genetically you are in the same position as the Brits, because tschutschensis is Eastern Yellow Wag, but plexa is classifed as eastern or western depending on whether you are AOU or IOC. However informally we thought the plumage of the Devon bird pushed it more into the tschutschensis camp.
Hope this helps. I know I've received samples from more than one person, and as I'm not at work to check there might be people who've sent stuff who aren't in this email. If you know of anyone, please pass this on.
Best wishes
Martin
Tory Island Yellow Wag EYW02 Oct 13 ND2 partial sequence L5216 Mota5502 GGCAAAACTAATTTTCATCACCAGCCTACT
CACTAATCTCAAAATCCCACCACCCGCGGG
GTACGGGACAATGGGACATTACCCAACTCA
Thursday, 6 March 2014
2013 Tory Island Bird Report print edition
The printed edition of the 2013 Tory Island Bird Reoprt will be available to buy in a few weeks. As last year, Chris Ingram has kindly arranged to get the report printed. All proceeds from the sale of the report will go to charity.
Anyone who is interested in buying a copy should contact Chris at chrisingram43
Monday, 10 February 2014
2013 Tory Island Bird Report
Its now available... just email me at pmpphillips@gmail.com.
Its 50MB in size. I cant quite figure out why!!but its downloadable
from google drive. There will also be a hard copy available to purchase
in the coming weeks. I will let you know the details....
Thursday, 19 December 2013
Glossy Ibis
News from a very windy Tory Island. Anton found a dead Glossy Ibis beneath the wires in west town. I think its a first for Tory.
Other news a Snow Bunting last week and what sounds like a Grey Phalarope in the harbour yesterday and today.
Very few blackbirds and just 3 Redwing. Lots of Goldfinch recently.
Other news a Snow Bunting last week and what sounds like a Grey Phalarope in the harbour yesterday and today.
Very few blackbirds and just 3 Redwing. Lots of Goldfinch recently.
Sunday, 3 November 2013
3rd November; Anton Meenan
I rang Anton to see what was about.The best from a wind blown Tory;
60 Redwing in various locations with many more heard flying over head.
A noticable increase in Snipe.
1 Siskin in the garden for a few days.
1-2 Blackcap in the garden most days towards the end of October. The birds mainly in the garden feeding on the apples.
No Barnacle Geese recently. (Maybe they have all arrived already...)
14 Greylag Geese at East town
60 Redwing in various locations with many more heard flying over head.
A noticable increase in Snipe.
1 Siskin in the garden for a few days.
1-2 Blackcap in the garden most days towards the end of October. The birds mainly in the garden feeding on the apples.
No Barnacle Geese recently. (Maybe they have all arrived already...)
14 Greylag Geese at East town
Saturday, 2 November 2013
1st November
News from Irishbirding
Joe Donaldson
1 Rose-coloured Starling
1 Snow Bunting
2 Chiffchaff
1 Purple Sandpiper
14 Greylag Geese
Joe Donaldson
1 Rose-coloured Starling
1 Snow Bunting
2 Chiffchaff
1 Purple Sandpiper
14 Greylag Geese
Subscribe to:
Posts (Atom)